Logo  
   
line decor
  
line decor
 
 
 
 
 
 
Online Translation of Genetic Sequences to Music

This will translate your input genetic sequence to a music file, in MIDI format, that will be e-mailed to the address you enter below. Also, the music should immediately play in your web browser (assuming your browser has the normal plug-ins to play MIDI music files.)

Optionally, if you use the Entrez database to browse gene sequences, you can add a "Play This Gene" button to Entrez's sequence viewer (see below).

This software was written by Dr. Frank K. Pettit from an algorithm by Rie Takahashi and Jeffrey H. Miller.

Instructions:

  1. Enter your e-mail address
  2. Enter genetic sequence
  3. Click the "Submit" button

Enter the email address to which the music file should be sent (we will not spam you, nor do we sell address lists.)

Use of uninitialized value in concatenation (.) or string at /data10/users/pettit/cgi-bin/gene2musicweb line 437. Email Address:
Use of uninitialized value in concatenation (.) or string at /data10/users/pettit/cgi-bin/gene2musicweb line 299.

Input Genetic Sequence

Genetic sequence should be in FASTA format: the first line starts with ">" and is followed by the name of the gene; the second, third lines etc. have the genetic sequence, e.g.:

> Human ThyA gene
ATGCCTGTGGCCGGCTCGGAGCTGCCGCGCCGGCCCTTGCCCCCCGCCGCACAG
GAGCGGGACGCCGAGCCG

...and so on. The first line (with "> gene name") is optional but recommended. Sequence may be uppercase or lowercase. Spaces are allowed. The maximum length of a single line is 4000 characters.

(If you don't have a gene sequence of your own but want to give it a try, here are a few example sequences that you can copy & paste in.)



Add a "Play This Gene" Button to the Entrez Sequence Viewer

Optionally, if you use the Entrez database to search for gene sequences, and if your web browser is Firefox, you can add a "Play This Gene" button to the FASTA view of any sequence in Entez's sequence viewer. This requires you install the Greasemonkey add-on to Firefox, if you haven't already. Thanks to Alf Eaton for the greasemonkey script.

Installation Instructions:

  1. Install Greasemonkey into your Firefox browser (if you haven't already).
  2. Open this page containing Alf Eaton's greasemonkey script.
  3. In the new browser window, go to menu Tools --> Greasemonkey --> Install User Script --> Install

When done, you can test the button on this example Entrez sequence.